liu.seSearch for publications in DiVA
Change search
ReferencesLink to record
Permanent link

Direct link
Characteristics of oligodeoxyribonucleotides that induce interferon (IFN)-alpha in the pig and the phenotype of the IFN-alpha producing cells
Swedish University of Agricultural Sciences, Uppsala, Sweden.
Swedish University of Agricultural Sciences, Uppsala, Sweden.
Swedish University of Agricultural Sciences, Uppsala, Sweden.
Swedish University of Agricultural Sciences, Uppsala, Sweden.
Show others and affiliations
2004 (English)In: Veterinary Immunology and Immunopathology, ISSN 0165-2427, E-ISSN 1873-2534, Vol. 101, no 1-2, 87-102 p.Article in journal (Refereed) Published
Abstract [en]

The immunostimulatory effects of oligodeoxyribonucleotides (ODN) containing unmethylated CpG dinucleotides (CpG-ODN) in certain base contexts have been extensively studied in man and mice. One major action is their ability to trigger production of massive amounts of interferon-alpha (IFN-alpha) by plasmacytoid dendritic cells (PDC), also referred to as natural IFN-alpha/beta producing cells (NIPC). The present study using porcine PBMC activated by CpG-ODN or plasmid DNA revealed a considerable variation in the IFN-alpha production in response to various CpG-ODN constructs. Several phosphodiester ODNs, such as 5 TTTTCAATTCGAAGATGAAT 3(ODN H), and the plasmid pcDNA3 all required pre-incubation with lipofectin in order to induce IFN-alpha. Intact unmethylated CpGs were also important, because methylation or substitution of the cytosines and CpG-inversion strongly reduced the IFN-alpha induction by single- or double-stranded forms of ODN H. Certain CpG-ODNs that contained flanking phosphorothioate or phosphodiester poly-G sequences were potent inducers of IFN-alpha without. pre-incubation with lipofectin, for instance the ODN 2216 (5 GGGGGACGATCGTCGGGGGG 3). While poly-G sequences have been suggested to increase uptake of ODNs by cells, they did not obviate the need for lipofectin when added to the ODN H. However, they resulted in up to five-fold increases of the IFN-a levels caused by ODN H upon lipofection, indicating other enhancing effects of poly-G sequences on the induction of IFN-alpha. The identity of the IFN-a producing cells (IPC) stimulated by CpG-ODN or plasmid DNA was studied by means of flow cytometry using combined staining for intracellular IFN-alpha and surface markers. Approximately 1-3 IPC/10(3) PBMC were detected, compared to only 3 IPC/10(4) PBMC stimulated by Aujeszkys disease virus. The IPC frequencies were confirmed by detection of IFN-alpha mRNA positive cells by in situ hybridisation. The IPC induced by CpG-ODN or plasmid DNA had a similar phenotype, expressing CD2 and CD4 and intermediate levels of MHC class II and the myeloid marker SWC3, but not the markers of T and B cells or monocytes (CD3, CD21 and CD14). Consequently, porcine IPC that respond to CpG-DNA seem to correspond to the PDC/NIPC. (C) 2004 Elsevier B.V. All rights reserved.

Place, publisher, year, edition, pages
Elsevier, 2004. Vol. 101, no 1-2, 87-102 p.
Keyword [en]
porcine; interferon; IFN-alpha producing cells; dendritic cells; CpG-DNA
National Category
Natural Sciences Medical and Health Sciences
URN: urn:nbn:se:liu:diva-87943DOI: 10.1016/j.vetimm.2004.04.017ISI: 000223091000007OAI: diva2:601193
Available from: 2013-01-28 Created: 2013-01-28 Last updated: 2013-02-12

Open Access in DiVA

No full text

Other links

Publisher's full text

Search in DiVA

By author/editor
Magnusson, Mattias
In the same journal
Veterinary Immunology and Immunopathology
Natural SciencesMedical and Health Sciences

Search outside of DiVA

GoogleGoogle Scholar
The number of downloads is the sum of all downloads of full texts. It may include eg previous versions that are now no longer available

Altmetric score

Total: 33 hits
ReferencesLink to record
Permanent link

Direct link