liu.seSearch for publications in DiVA
Change search
Refine search result
1 - 30 of 30
CiteExportLink to result list
Permanent link
Cite
Citation style
  • apa
  • harvard1
  • ieee
  • modern-language-association-8th-edition
  • vancouver
  • oxford
  • Other style
More styles
Language
  • de-DE
  • en-GB
  • en-US
  • fi-FI
  • nn-NO
  • nn-NB
  • sv-SE
  • Other locale
More languages
Output format
  • html
  • text
  • asciidoc
  • rtf
Rows per page
  • 5
  • 10
  • 20
  • 50
  • 100
  • 250
Sort
  • Standard (Relevance)
  • Author A-Ö
  • Author Ö-A
  • Title A-Ö
  • Title Ö-A
  • Publication type A-Ö
  • Publication type Ö-A
  • Issued (Oldest first)
  • Issued (Newest first)
  • Created (Oldest first)
  • Created (Newest first)
  • Last updated (Oldest first)
  • Last updated (Newest first)
  • Disputation date (earliest first)
  • Disputation date (latest first)
  • Standard (Relevance)
  • Author A-Ö
  • Author Ö-A
  • Title A-Ö
  • Title Ö-A
  • Publication type A-Ö
  • Publication type Ö-A
  • Issued (Oldest first)
  • Issued (Newest first)
  • Created (Oldest first)
  • Created (Newest first)
  • Last updated (Oldest first)
  • Last updated (Newest first)
  • Disputation date (earliest first)
  • Disputation date (latest first)
Select
The maximal number of hits you can export is 250. When you want to export more records please use the Create feeds function.
  • 1.
    Bian, Li
    et al.
    University of Gothenburg, Sweden .
    Josefsson, Elisabet
    University of Gothenburg, Sweden .
    Jonsson, Ing-Marie
    University of Gothenburg, Sweden .
    Verdrengh, Margareta
    University of Gothenburg, Sweden .
    Ohlsson, Claes
    Sahlgrens University Hospital, Sweden .
    Bokarewa, Maria
    University of Gothenburg, Sweden .
    Tarkowski, Andrej
    University of Gothenburg, Sweden .
    Magnusson, Mattias
    University of Gothenburg, Sweden .
    Dichloroacetate alleviates development of collagen II-induced arthritis in female DBA/1 mice2009In: ARTHRITIS RESEARCH and THERAPY, ISSN 1478-6354, Vol. 11, no 5Article in journal (Refereed)
    Abstract [en]

    Introduction Dichloroacetate (DCA) has been in clinical use for the treatment of lactacidosis and inherited mitochondrial disorders. It has potent anti-tumor effects both in vivo and in vitro, facilitating apoptosis and inhibiting proliferation. The proapoptotic and anti-proliferative properties of DCA prompted us to investigate the effects of this compound in arthritis. Methods In the present study, we used DCA to treat murine collagen type II (CII)-induced arthritis (CIA), an experimental model of rheumatoid arthritis. DBA/1 mice were treated with DCA given in drinking water. Results Mice treated with DCA displayed much slower onset of CIA and significantly lower severity (P less than 0.0001) and much lower frequency (36% in DCA group vs. 86% in control group) of arthritis. Also, cartilage and joint destruction was significantly decreased following DCA treatment (P = 0.005). Moreover, DCA prevented arthritis-induced cortical bone mineral loss. This clinical picture was also reflected by lower levels of anti-CII antibodies in DCA-treated versus control mice, indicating that DCA affected the humoral response. In contrast, DCA had no effect on T cell-or granulocyte-mediated responses. The beneficial effect of DCA was present in female DBA/1 mice only. This was due in part to the effect of estrogen, since ovariectomized mice did not benefit from DCA treatment to the same extent as sham-operated controls (day 30, 38.7% of ovarectomized mice had arthritis vs. only 3.4% in sham-operated group). Conclusion Our results indicate that DCA delays the onset and alleviates the progression of CIA in an estrogen-dependent manner.

  • 2.
    Blomberg, Stina
    et al.
    Uppsala University Hospital, Swedenj.
    Eloranta, Maija-Leena
    Swedish University of Agriculture Science, Uppsala, Sweden ).
    Magnusson, Mattias
    Swedish University of Agriculture Science, Uppsala, Sweden ).
    Alm, Gunnar V.
    Swedish University of Agriculture Science, Uppsala, Sweden ).
    Rönnblom, Lars
    Uppsala University Hospital, Sweden.
    Expression of the markers BDCA-2 and BDCA-4 and production of interferon-alpha by plasmacytoid dendritic cells in systemic lupus erythematosus2003In: Arthritis and Rheumatism, ISSN 0004-3591, E-ISSN 1529-0131, Vol. 48, no 9, p. 2524-2532Article in journal (Refereed)
    Abstract [en]

    Objective

    To study the expression of blood dendritic cell antigen 2 (BDCA-2) and BDCA-4 molecules by plasmacytoid dendritic cells (PDCs) in the blood of patients with systemic lupus erythematosus (SLE), and to study PDC production of interferon-α (IFNα) and its inhibition by anti–BDCA-2 and anti–BDCA-4 antibodies.

    Methods

    Peripheral blood mononuclear cells (PBMCs) from SLE patients (SLE PBMCs) and from healthy controls were induced to produce IFNα in vitro by SLE serum containing an endogenous IFNα-inducing factor (SLE-IIF) or by herpes simplex virus type 1 (HSV-1). The frequencies and numbers of BDCA-2–, BDCA-3–, and BDCA-4–expressing cells were analyzed by flow cytometry, and the effects of anti–BDCA-2 and anti–BDCA-4 monoclonal antibodies (mAb) on IFNα production were investigated.

    Results

    IFNα production by SLE PBMCs induced by SLE-IIF or HSV-1 was decreased compared with that of healthy control PBMCs (P = 0.002 and P = 0.0007, respectively). The proportions of BDCA-2– and BDCA-3–expressing cells in SLE PBMCs were reduced compared with those in PBMCs from healthy controls (P = 0.01 and P = 0.004, respectively). IFNα producers in culture, especially among SLE PBMCs, displayed reduced BDCA-2 expression and constituted only a minority of the BDCA-2–positive cells, at least in healthy control PBMCs (median 18%). IFNα production by both SLE and healthy control PBMCs stimulated by SLE-IIF or HSV-1 was markedly reduced by anti–BDCA-2 mAb (median 81–98% inhibition). Anti–BDCA-4 mAb only partially inhibited SLE-IIF–induced IFNα production.

    Conclusion

    SLE patients had a reduced number of BDCA-2–expressing PDCs, also termed natural IFNα-producing cells, and their IFNα production could be inhibited by anti–BDCA-2/4 mAb. Such mAb may be a therapeutic option for inhibiting the ongoing IFNα production in SLE patients.

  • 3.
    Bokarewa, M
    et al.
    University of Gothenburg, Sweden; .
    Tarkowski, A.
    University of Gothenburg, Sweden; .
    Magnusson, Mattias
    University of Gothenburg, Sweden; .
    Pathological survivin expression links viral infections with pathogenesis of erosive rheumatoid arthritis2007In: Scandinavian Journal of Immunology, ISSN 0300-9475, E-ISSN 1365-3083, Vol. 66, no 2-3, p. 192-198Article, review/survey (Refereed)
    Abstract [en]

    Rheumatoid arthritis (RA) is an inflammatory joint disease leading to cartilage and bone destruction. Insufficient apoptosis in the inflamed RA synovium along with accumulation of highly differentiated B- and T-lymphocytes as well as invasive growth of macrophages and fibroblasts is among the major mechanisms supporting joint destruction. We have recently shown that circulating survivin, an apoptotis inhibitor tightly bound to tumorigenesis, is an independent predictor of development and progression of joint destruction in RA. In this review we discuss the possible connectivity between viral infection, leading to interferon (IFN)-alpha production, survivin expression, and subsequent joint inflammation. The role of IFN-a and the involvement of IFN transcription factors and phosphoinositide-3-kinase signalling as essential modulators of arthritogenic process are discussed in the context of survivin.

  • 4.
    Bokarewa, Maria
    et al.
    Sahlgrenska University Hospital, Göteborg, Sweden.
    Tarkowski, Andrej
    Lind, Magnus
    Sahlgrenska University Hospital, Göteborg, Sweden.
    Dahlberg, Leif
    Lund University, Sweden .
    Magnusson, Mattias
    Sahlgrenska University Hospital, Göteborg, Sweden.
    Arthritogenic dsRNA is present in synovial fluid from rheumatoid arthritis patients with an erosive disease course2008In: European Journal of Immunology, ISSN 0014-2980, E-ISSN 1521-4141, Vol. 38, no 11, p. 3237-3244Article in journal (Refereed)
    Abstract [en]

    Viruses may be part of the pathogenesis of rheumatoid arthritis (RA). Double stranded RNA (dsRNA) is a prototypic viral conformation of nucleic acid that is highly arthritogenic in mice. Therefore, we developed an ELISA to detect dsRNA in sera and synovial fluids (SF) in RA patients and in osteoarthritic controls. The developed ELISA recognizes picogram levels of viral or synthetic dsRNA but shows no reactivity against DNA, synthetic ssRNA, or total RNA prepared from mammalian cells. Before analysis by ELISA, each sample was subjected to RNA precipitation. The RA patients had significantly higher levels of dsRNA than the osteoarthritis patients in SF and in sera. In 7 of 17 RA patients, EBV was present in SF and in all but one of these this was accompanied by the presence of dsRNA. No parvovirus, cytomegalovirus, or polyomavirus was detected. The anti-viral cytokine IFN-alpha was detected in SF in 10 of 21 RA patients, but in none of the osteoarthritis patients. Notably, RA patients with erosive disease course had significantly higher levels of dsRNA in SF than non-erosive patients, but no correlation between dsRNA levels and the presence of RF or levels of C-reactive protein, IL-6, or IFN-alpha was observed.

  • 5.
    Båve, Ullvi
    et al.
    Uppsala University, Sweden.
    Magnusson, Mattias
    Swedish University of Agriculture Science, Uppsala, Sweden .
    Eloranta, Maija-Leena
    Swedish University of Agriculture Science, Uppsala, Sweden .
    Perers, Anders
    Swedish University of Agriculture Science, Uppsala, Sweden .
    Alm, Gunnar V.
    Swedish University of Agriculture Science, Uppsala, Sweden .
    Rönnblom, Lars
    Uppsala University, Sweden.
    Fc gamma RIIa is expressed on natural IFN-alpha-producing cells (plasmacytoid dendritic cells) and is required for the IFN-alpha production induced by apoptotic cells combined with lupus IgG2003In: Journal of Immunology, ISSN 0022-1767, E-ISSN 1550-6606, Vol. 171, no 6, p. 3296-3302Article in journal (Refereed)
    Abstract [en]

    An ongoing production of IFN-alpha may be of etiopathogenic significance in systemic lupus erythematosus (SLE). It may be due to the natural IFN-producing cells (NIPC), also termed plasmacytoid dendritic cells (PDC), activated by immune complexes that contain nucleic acids derived from apoptotic cells. We here examined the role of FcgammaR in the IFN-alpha production in vitro by PBMC induced by the combination of apoptotic U937 cells and autoantibody-containing IgG from SLE patients (SLE-IgG). The Fc portion of the SLE-IgG was essential to induce IFN-alpha production, because Fab fragments or F(ab)(2) were ineffective. Normal, especially heat-aggregated, IgG inhibited the IFN-alpha production, suggesting a role for FcgammaR on PBMC. Using blocking anti-FcgammaR Abs, the FcgammaRIIa,c (CD32) but not FcgammaRI or FcgammaRIII were shown to be involved in the IFN-alpha induction by apoptotic cells combined with SLE-IgG, but not by HSV or CpG DNA. In contrast, the action of all of these inducers was inhibited by the anti-FcgammaRIIa,b,c mAb AT10 or heat-aggregated IgG. Flow cytometric analysis revealed that similar to50% of the BDCA-2-positive PBMC, i.e., NIPC/PDC, expressed low but significant levels of FcgammaRII, as did most of the actual IFN-a producers activated by HSV. RT-PCR applied to NIPC/PDC purified by FACS demonstrated expression of FcgammaRIIa, but not of FcgammaRIIb or FcgammaRIIc. We conclude that FcgammaRIIa on NIPC/PDC is involved in the activation of IFN-alpha production by interferogenic immune complexes, but may also mediate inhibitory signals. The FcgammaRIIa could therefore have a key function in NIPC/PDC and be a potential therapeutic target in SLE.

  • 6.
    Chalise, Jaya Prakash
    et al.
    Linköping University, Department of Clinical and Experimental Medicine, Division of Neuro and Inflammation Science. Linköping University, Faculty of Medicine and Health Sciences.
    Chenna Narendra, Sudeep
    Linköping University, Department of Clinical and Experimental Medicine, Division of Neuro and Inflammation Science. Linköping University, Faculty of Medicine and Health Sciences.
    Biggs, Sophie
    Region Östergötland, Heart and Medicine Center, Department of Rheumatology.
    Kalinke, Ulrich
    Twincore, Germany.
    Iacono, Alberta
    Department of Experimental Medicine, University of Perugia, Perugia, Italy.
    Boon, Louis
    EPIRUS Biopharmaceuticals, Utrecht, Netherlands.
    Magnusson, Mattias
    Linköping University, Department of Clinical and Experimental Medicine, Division of Neuro and Inflammation Science. Linköping University, Faculty of Medicine and Health Sciences.
    Regulatory T cells manifest IFN-α mediated protection during antigen induced arthritisManuscript (preprint) (Other academic)
    Abstract [en]

    Introduction

    Type I interferon induces tolerance against arthritogenic antigen and protects against antigen induced arthritis (AIA). Regulatory T cells (Treg cells) resolve aberrant immune reaction, maintain self-tolerance and prevent the development of autoimmune diseases. We here investigated the impact of Interferon alpha (IFN-α) on Treg cells development and function during antigen induced arthritis.

    Methods

    For AIA, mice were immunized with methylated bovine serum albumin (mBSA) at day 1 and 7 in presence or absence of IFN-α. At day 21, arthritis was induced by intra-articular injection of mBSA and arthritis was evaluated at day 28. At various days of AIA, CD4, CD25, Foxp3 and CTLA-4 expression was quantified by FACS in blood cells, splenocytes, lymph nodes cells and in ex vivo re-stimulated leucocytes (pooled splenocytes and lymph nodes cells) isolated at same days. To investigate the importance of Treg cells in IFN-α protection in AIA, Foxp3DTReGFP+mice were used, where Treg cells can be depleted transiently by administration of diptherin toxin. CFSE based suppression assay was used to assess the suppression by Treg cells isolated day 4, 10, 20 of AIA against proliferation of mBSA or anti-CD3 stimulated responder T cells (Tresp cells) isolated at same days. For adoptive transfer experiments, 250,000 Treg cells from IFN-α treated or untreated mice day 20 of AIA were intravenously injected to recipient pre-immunized mice without IFN-α treatment during the induction of arthritis. The importance of IFN-α signalling on T cells for the IFN-α protection was evaluated by using CD4-Cre+/- IFNAR flox/flox mice.

    Results

    Protective effects of IFN-α in AIA were associated with significant TGF-β dependent increase in Foxp3+ T cells in blood at day 4 and minor increase of Foxp3+T cells in spleen and lymph node cells. However IFN-α signalling in T cells is not required for IFN-α-protection. Upon ex vivo re-stimulation in presence of IFN-α with mBSA but not anti-CD3, the Treg cells numbers were increased in leucocytes isolated from day 4 and day 10 of AIA. Transient depletion of Treg cells during induction of arthritis (day 21) abolished IFN-α-protection however the protection was not affected when Treg cells are depleted during immunization phase (day 1 and day 7). Against mBSA-stimulated proliferation of Tresp cells, suppression by Treg cells isolated from day 10 and day 20 from IFN-α treated mice are significantly higher than Treg cells from untreated mice. Treg cells isolated from IFN-α or untreated mice at day 20 of AIA when transferred to pre-immunized untreated mice prevent the development of arthritis.

    Conclusion

    Treg cells are critically associated with IFN-α protective effects in AIA. IFN-α enhances TGF-β dependent early development of Treg cells and later IFN-α enhances their suppressive capacity against T cells proliferation in antigen specific manner during AIA.

  • 7.
    Chalise, Jaya Prakash
    et al.
    Linköping University, Department of Clinical and Experimental Medicine, Division of Inflammation Medicine. Linköping University, Faculty of Health Sciences.
    Narendra, Sudeep Chenna
    Linköping University, Department of Clinical and Experimental Medicine, Division of Inflammation Medicine. Linköping University, Faculty of Health Sciences.
    Paudyal, Bhesh Raj
    Linköping University, Department of Clinical and Experimental Medicine. Linköping University, Faculty of Health Sciences.
    Magnusson, Mattias
    Linköping University, Department of Clinical and Experimental Medicine, Division of Inflammation Medicine. Linköping University, Faculty of Health Sciences.
    Interferon alpha inhibits antigen-specific production of proinflammatory cytokines and enhances antigen-specific transforming growth factor beta production in antigen-induced arthritis2013In: Arthritis Research and Therapy, ISSN 1478-6354, Vol. 15, no 5, p. R143-Article in journal (Refereed)
    Abstract [en]

    Introduction: Interferon alpha (IFN-α) has a complex role in autoimmunity, in that it may both enhance and prevent inflammation. We have previously shown that the presence of IFN-α at sensitization protects against subsequent antigen-triggered arthritis. To understand this tolerogenic mechanism, we performed a descriptive, hypothesis-generating study of cellular and humoral responses associated with IFN-α-mediated protection against arthritis.Methods: Arthritis was evaluated at day 28 in mice given a subcutaneous injection of methylated bovine serum albumin (mBSA), together with Freund adjuvant and 0 to 5,000 U IFN-α at days 1 and 7, followed by intraarticular injection of mBSA alone at day 21. The effect of IFN-α on mBSA-specific IgG1, IgG2a, IgG2b, IgA, and IgE was evaluated by enzyme-linked immunosorbent assay (ELISA). Cytokines in circulation and in ex vivo cultures on mBSA restimulation was evaluated with ELISA and Luminex, and the identity of cytokine-producing cells by fluorescence-activated cell sorting (FACS) analysis.Results: Administration of IFN-α protected mice from arthritis in a dose-dependent manner but had no effect on antigen-specific antibody levels. However, IFN-α did inhibit the initial increase of IL-6, IL-10, IL-12, and TNF, and the recall response induced by intraarticular mBSA challenge of IL-1β, IL-10, IL-12, TNF, IFN-γ, and IL-17 in serum. IFN-α decreased both macrophage and CD4+ T cell-derived IFN-γ production, whereas IL-17 was decreased only in CD4+ T cells. Ex vivo, in mBSA-restimulated spleen and lymph node cell cultures, the inhibitory effect of in vivo administration of IFN-α on proinflammatory cytokine production was clearly apparent, but had a time limit. An earlier macrophage-derived, and stronger activation of the antiinflammatory cytokine transforming growth factor beta (TGF-β) was observed in IFN-α-treated animals, combined with an increase in CD4+ T cells producing TGF-β when arthritis was triggered by mBSA (day 21). Presence of IFN-α at immunizations also prevented the reduction in TGF-β production, which was induced by the intraarticular mBSA injection triggering arthritis in control animals.Conclusions: Administration of IFN-α has a profound effect on the cellular response to mBSA plus adjuvant, but does not affect antigen-specific Ig production. By including IFN-α at immunizations, spleen and lymph node cells inhibit their repertoire of antigen-induced proinflammatory cytokines while enhancing antiinflammatory TGF-β production, first in macrophages, and later also in CD4+ T cells. On intraarticular antigen challenge, this antiinflammatory state is reenforced, manifested as inhibition of proinflammatory recall responses and preservation of TGF-β levels. This may explain why IFN-α protects against antigen-induced arthritis. © 2013 Chalise et al.; licensee BioMed Central Ltd.

  • 8.
    Chalise, Jaya Prakash
    et al.
    Linköping University, Department of Clinical and Experimental Medicine, Division of Neuro and Inflammation Science. Linköping University, Faculty of Medicine and Health Sciences.
    Pallotta, Maria Teresa
    Department of Experimental Medicine, University of Perugia, Perugia, Italy.
    Chenna Narendra, Sudeep
    Linköping University, Department of Clinical and Experimental Medicine, Division of Neuro and Inflammation Science. Linköping University, Faculty of Medicine and Health Sciences.
    Carlsson, Björn
    Linköping University, Department of Medical and Health Sciences, Division of Drug Research. Linköping University, Faculty of Medicine and Health Sciences. Region Östergötland, Center for Diagnostics, Department of Clinical Pharmacology.
    Iacono, Alberta
    Department of Experimental Medicine, University of Perugia, Perugia, Italy.
    Boon, Louis
    EPIRUS Biopharmaceuticals, Utrecht, Netherlands.
    Grohmann, Ursula
    Department of Experimental Medicine, University of Perugia, Perugia, Italy.
    Magnusson, Mattias
    Linköping University, Department of Clinical and Experimental Medicine, Division of Neuro and Inflammation Science. Linköping University, Faculty of Medicine and Health Sciences.
    IDO1 and TGF- 1 β mediate protective effects of IFN-α in antigen-induced arthritisManuscript (preprint) (Other academic)
    Abstract [en]

    Interferon-α (IFN-α) prevents antigen-induced arthritis (AIA) in mice by an unknown mechanism. Indoleamine 2, 3 dioxygenase 1 (IDO1) is an immunoregulator via enzymatic as well as signalling activity, which can be activated by TGF-β and further mediated via non canonical NF-κB signalling. We here investigated whether IDO1 and TGF-β are involved in IFN-α protective effects in AIA. Arthritis was induced in wt, Ido1-/- or Ifnar-/- mice, treated or not with IFN-α or kynurenine, the main IDO1 product, and antibodies neutralizing TGF-β or 1-methyltryptophan (1-MT), an inhibitor of IDO1 catalytic activity. IDO1 expression and enzymatic activity were determined by RT-PCR and HPLC, respectively. Proliferation was measured by 3H-Thymidine incorporation. Non-canonical NF-κB signalling was evaluated by ELISA and Western blot in plasmacytoid DCs (pDCs) from treated mice. Protective effects of IFN-α in AIA were associated with increased IDO1 expression and kynurenine production in spleen cells, particularly at the time of mBSA sensitization. Lack of IDO1 ablated IFN-α protection and kynurenine prevented AIA in an IFNAR-independent manner. The IDO1 catalytic activity was crucial for IFN-α effects at the sensitization but not effector phase of AIA. The disease effector phase in mice treated with IFN-α was instead characterized by sustained IDO1 and TGF-β expression and activation of the noncanonical NF-κB pathway in pDCs. IFN-α protective effects in AIA involves IDO1 enzymatic and signalling activity in the disease sensitization and effector phase, respectively. Kynurenine, the main IDO1 metabolite, can be used as an alternative treatment to IFN-α in protecting mice from AIA.

  • 9.
    Chenna Narendra, Sudeep
    et al.
    Linköping University, Department of Clinical and Experimental Medicine, Division of Neuro and Inflammation Science. Linköping University, Faculty of Medicine and Health Sciences.
    Prakash Chalise, Jaya
    Linköping University, Department of Clinical and Experimental Medicine, Division of Neuro and Inflammation Science. Linköping University, Faculty of Medicine and Health Sciences.
    Magnusson, Mattias
    Linköping University, Department of Clinical and Experimental Medicine, Division of Neuro and Inflammation Science. Linköping University, Faculty of Medicine and Health Sciences.
    Uppugunduri, Srinivas
    Linköping University, Department of Clinical and Experimental Medicine, Division of Microbiology and Molecular Medicine. Linköping University, Faculty of Medicine and Health Sciences. Region Östergötland, Center for Diagnostics, Department of Clinical Chemistry.
    Local but Not Systemic Administration of Uridine Prevents Development of Antigen-Induced Arthritis2015In: PLoS ONE, ISSN 1932-6203, E-ISSN 1932-6203, Vol. 10, no 10, p. e0141863-Article in journal (Refereed)
    Abstract [en]

    Objective Uridine has earlier been show to down modulate inflammation in models of lung inflammation. The aim of this study was to evaluate the anti-inflammatory effect of uridine in arthritis. Methods Arthritis was induced by intra-articular injection of mBSA in the knee of NMRI mice preimmunized with mBSA. Uridine was either administered locally by direct injection into the knee joint or systemically. Systemic treatment included repeated injections or implantation of a pellet continuously releasing uridine during the entire experimental procedure. Anti-mBSA specific immune responses were determined by ELISA and cell proliferation and serum cytokine levels were determined by Luminex. Immunohistochemistry was used to identify cells, study expression of cytokines and adhesion molecules in the joint. Results Local administration of 25-100 mg/kg uridine at the time of arthritis onset clearly prevented development of joint inflammation. In contrast, systemic administration of uridine (max 1.5 mg uridine per day) did not prevent development of arthritis. Protection against arthritis by local administration of uridine did not affect the anti-mBSA specific immune response and did not prevent the rise in serum levels of pro-inflammatory cytokines associated with the triggering of arthritis. In contrast, local uridine treatment efficiently inhibited synovial expression of ICAM-1 and CD18, local cytokine production and recruitment of leukocytes to the synovium. Conclusion Local, but not systemic administration of uridine efficiently prevented development of antigen- induced arthritis. The protective effect did not involve alteration of systemic immunity to mBSA but clearly involved inhibition of synovial expression of adhesion molecules, decreased TNF and IL-6 production and prevention of leukocyte extravasation. Further, uridine is a small, inexpensive molecule and may thus be a new therapeutic option to treat joint inflammation in RA.

  • 10.
    Dehlin, Mats
    et al.
    University of Gothenburg, Sweden .
    Bokarewa, Maria
    University of Gothenburg, Sweden .
    Rottapel, Robert
    University of Toronto, Canada .
    Foster, Simon J
    University of Sheffield, England .
    Magnusson, Mattias
    University of Gothenburg, Sweden .
    Dahlberg, Leif E
    University Hospital UMAS, Malmo, Sweden.
    Tarkowski, Andrej
    University of Gothenburg, Sweden .
    Intra-Articular Fms-Like Tyrosine Kinase 3 Ligand Expression Is a Driving Force in Induction and Progression of Arthritis2008In: PLoS ONE, ISSN 1932-6203, E-ISSN 1932-6203, Vol. 3, no 11Article in journal (Refereed)
    Abstract [en]

    Background: One of the hallmarks of rheumatoid arthritis ( RA) is hyperplasia and inflammation of the synovial tissue being characterized by in situ occurrence of highly differentiated leukocytes. Fms-like tyrosine kinase 3 (Flt3) has a crucial role in hematopoiesis, regulation of cell proliferation, differentiation and apoptosis. Typically, Flt3 is expressed on early myeloid and lymphoid progenitors and is activated by its soluble ligand (Flt3-L). The highly differentiated cellular pattern in the synovium of the RA patients made us hypothesize that Flt3-L, with its ability to induce proliferation and differentiation, could be of importance in induction and/or progression of arthritis. Methodology/Principal Findings: To investigate occurrence of Flt3-L in RA we have measured its levels in matched serum and synovial fluid samples from 130 patients and 107 controls. To analyse the pro-inflammatory role of Flt3-L, we continuously overexpressed this protein locally in healthy mouse joints using homologous B-cell line transfected with Flt3-L gene. Additionally, recombinant Flt3-L was instillated intra-articularly in combination with peptidoglycans, a Toll Like Receptor 2-ligand with stong arthritogenic properties. Our results show significantly higher levels of Flt3-L in the synovial fluid as compared to serum levels in RA subjects (p=0.0001). In addition, RA synovial fluid levels of Flt-3-L were significantly higher than these obtained from synovial fluids originating fromnon-inflammatory joint diseases (p=0.022). Intra-articular administration of B-cell line transfected with Flt3-L gene resulted in highly erosive arthritis while inoculation of the same B-cell line without hyperexpression of Flt3-L did not induce erosivity and only in a minority of cases caused synovial proliferation! Flt3-ligand potentiated peptidoglycan induced arthritis as compared to mice injected with peptidoglycan alone (p less than 0.05). Conclusions/Significance: Our findings indicate that Flt3-L is strongly expressed at the site of inflammation in human RA. It exerts both pro-inflammatory and tissue destructive properties once in the joint cavity. Owing to these properties, treatment attempts to neutralize this molecule should be considered in RA.

  • 11.
    Domeika, Kristina
    et al.
    Swedish University of Agricultural Sciences, Uppsala, Sweden.
    Magnusson, Mattias
    Swedish University of Agricultural Sciences, Uppsala, Sweden.
    Eloranta, Maija-Leena
    Swedish University of Agricultural Sciences, Uppsala, Sweden.
    Fuxler, Lisbeth
    Swedish University of Agricultural Sciences, Uppsala, Sweden.
    Alm, Gunnar V.
    Swedish University of Agricultural Sciences, Uppsala, Sweden.
    Fossum, Caroline
    Swedish University of Agricultural Sciences, Uppsala, Sweden.
    Characteristics of oligodeoxyribonucleotides that induce interferon (IFN)-alpha in the pig and the phenotype of the IFN-alpha producing cells2004In: Veterinary Immunology and Immunopathology, ISSN 0165-2427, E-ISSN 1873-2534, Vol. 101, no 1-2, p. 87-102Article in journal (Refereed)
    Abstract [en]

    The immunostimulatory effects of oligodeoxyribonucleotides (ODN) containing unmethylated CpG dinucleotides (CpG-ODN) in certain base contexts have been extensively studied in man and mice. One major action is their ability to trigger production of massive amounts of interferon-alpha (IFN-alpha) by plasmacytoid dendritic cells (PDC), also referred to as natural IFN-alpha/beta producing cells (NIPC). The present study using porcine PBMC activated by CpG-ODN or plasmid DNA revealed a considerable variation in the IFN-alpha production in response to various CpG-ODN constructs. Several phosphodiester ODNs, such as 5 TTTTCAATTCGAAGATGAAT 3(ODN H), and the plasmid pcDNA3 all required pre-incubation with lipofectin in order to induce IFN-alpha. Intact unmethylated CpGs were also important, because methylation or substitution of the cytosines and CpG-inversion strongly reduced the IFN-alpha induction by single- or double-stranded forms of ODN H. Certain CpG-ODNs that contained flanking phosphorothioate or phosphodiester poly-G sequences were potent inducers of IFN-alpha without. pre-incubation with lipofectin, for instance the ODN 2216 (5 GGGGGACGATCGTCGGGGGG 3). While poly-G sequences have been suggested to increase uptake of ODNs by cells, they did not obviate the need for lipofectin when added to the ODN H. However, they resulted in up to five-fold increases of the IFN-a levels caused by ODN H upon lipofection, indicating other enhancing effects of poly-G sequences on the induction of IFN-alpha. The identity of the IFN-a producing cells (IPC) stimulated by CpG-ODN or plasmid DNA was studied by means of flow cytometry using combined staining for intracellular IFN-alpha and surface markers. Approximately 1-3 IPC/10(3) PBMC were detected, compared to only 3 IPC/10(4) PBMC stimulated by Aujeszkys disease virus. The IPC frequencies were confirmed by detection of IFN-alpha mRNA positive cells by in situ hybridisation. The IPC induced by CpG-ODN or plasmid DNA had a similar phenotype, expressing CD2 and CD4 and intermediate levels of MHC class II and the myeloid marker SWC3, but not the markers of T and B cells or monocytes (CD3, CD21 and CD14). Consequently, porcine IPC that respond to CpG-DNA seem to correspond to the PDC/NIPC. (C) 2004 Elsevier B.V. All rights reserved.

  • 12.
    Fei, Ying
    et al.
    Gothenburg University.
    Wang, Wanzhong
    Gothenburg University.
    Kwiecinski, Jakub
    Gothenburg University.
    Josefsson, Elisabet
    Gothenburg University.
    Pullerits, Rille
    Gothenburg University.
    Jonsson, Ing-Marie
    Gothenburg University.
    Magnusson, Mattias
    Linköping University, Faculty of Health Sciences. Linköping University, Department of Clinical and Experimental Medicine, Clinical Immunology.
    Jin, Tao
    Gothenburg University.
    The Combination of a Tumor Necrosis Factor Inhibitor and Antibiotic Alleviates Staphylococcal Arthritis and Sepsis in Mice2011In: JOURNAL OF INFECTIOUS DISEASES, ISSN 1537-6613, Vol. 204, no 3, p. 348-357Article in journal (Refereed)
    Abstract [en]

    Background. Despite advances in medical practices, in recent decades permanent reductions in joint function have not been achieved, and the high mortality rate of patients with staphylococcal septic arthritis has not substantially improved. Methods. We evaluated the effects of a combined tumor necrosis factor (TNF) inhibitor and antibiotic therapy on the course of Staphylococcus aureus arthritis and sepsis in mice. Results. Treatment with the combination of a TNF inhibitor and an antibiotic resulted in a quicker relief of clinical arthritis in mice with septic arthritis, compared with an antibiotic monotherapy. Both histopathologically verified synovitis and the extent of joint destruction were reduced by this combined treatment. Importantly, anti-TNF treatment significantly improved the survival rate of mice with S. aureus sepsis and staphylococcal enterotoxin shock syndrome; this effect might be the result of a partial restoration of the hemostatic balance between coagulation and fibrinolysis. Finally, we demonstrated that anti-TNF treatment downregulates high-mobility group protein B1 in staphylococcal enterotoxin shock syndrome. Conclusions. Thus, simultaneous systemic TNF inhibition and antibiotic therapy has beneficial effects on the outcome of S. aureus arthritis and sepsis in a mouse model, suggesting that the combination of a TNF inhibitor and antibiotics represents a novel therapeutic strategy for the treatment of staphylococcal infections.

  • 13.
    Forsman, Huamei
    et al.
    University of Gothenburg.
    Islander, Ulrika
    University of Gothenburg.
    Andréasson, Emil
    University of Gothenburg.
    Andersson, Annica
    University of Gothenburg.
    Önnheim, Karin
    University of Gothenburg.
    Karlström, Alexandra
    University of Gothenburg.
    Sävman, Karin
    University of Gothenburg.
    Magnusson, Mattias
    Linköping University, Faculty of Health Sciences. Linköping University, Department of Clinical and Experimental Medicine, Medical Immunology.
    Brown, Kelly L
    University of Gothenburg.
    Karlsson, Anna
    University of Gothenburg.
    Galectin 3 Aggravates Joint Inflammation and Destruction in Antigen-Induced Arthritis2011In: ARTHRITIS AND RHEUMATISM, ISSN 0004-3591, Vol. 63, no 2, p. 445-454Article in journal (Refereed)
    Abstract [en]

    Objective. Galectin 3, an endogenous beta galactoside-binding lectin, plays an important role in the modulation of immune responses. The finding that galectin 3 is present in the inflamed synovium in patients with rheumatoid arthritis suggests that the protein is associated with the pathogenesis of this disease. We undertook this study to investigate the influence of galectin 3 deficiency in a murine model of arthritis. Methods. Wild-type (WT) and galectin 3-deficient (galectin 3(-/-)) mice were subjected to antigen-induced arthritis (AIA) through immunization with methylated bovine serum albumin. The concentration of serum cytokines (interleukin-6 [IL-6] and tumor necrosis factor alpha [TNF alpha]) and antigen-specific antibodies was evaluated using a cytometric bead array platform and enzyme-linked immunosorbent assay (ELISA). Cellular IL-17 responses were examined by flow cytometry, ELISA, and enzyme-linked immunospot assay. Results. The joint inflammation and bone erosion of AIA were markedly suppressed in galectin 3(-/-) mice as compared with WT mice. The reduced arthritis in galectin 3(-/-) mice was accompanied by decreased levels of antigen-specific IgG and proinflammatory cytokines. The frequency of IL-17-producing cells in the spleen was reduced in galectin 3(-/-) mice as compared with WT mice. Exogenously added recombinant galectin 3 could partially restore the reduced arthritis and cytokines in galectin 3(-/-) mice. Conclusion. Our findings show that galectin 3 plays a pathogenic role in the development and progression of AIA and that the disease severity is accompanied by alterations of antigen-specific IgG levels, systemic levels of TNF alpha and IL-6, and frequency of IL-17-producing T cells. To our knowledge, this is the first report of in vivo evidence that galectin 3 plays a crucial role in the development of arthritis.

  • 14.
    Hasslung Wikström, Frida
    et al.
    Swedish University of Agriculture Science, Uppsala, Sweden .
    Meehan, Brian M.
    Veterinary Science, Queen's University Belfast, UK.
    Berg, Mikael
    Swedish University of Agriculture Science, Uppsala, Sweden .
    Timmusk, Sirje
    Swedish University of Agriculture Science, Uppsala, Sweden .
    Elving, Josefine
    Swedish University of Agriculture Science, Uppsala, Sweden .
    Fuxler, Lisbeth
    Swedish University of Agriculture Science, Uppsala, Sweden .
    Magnusson, Mattias
    Swedish University of Agriculture Science, Uppsala, Sweden .
    Allan, Gordon M.
    Agri-Food and Biosciences Institute, Stormont, Belfast, UK.
    McNeilly, Francis
    Agri-Food and Biosciences Institute, Stormont, Belfast, UK.
    Fossum, Caroline
    Swedish University of Agriculture Science, Uppsala, Sweden .
    Structure-dependent modulation of alpha interferon production by porcine circovirus 2 oligodeoxyribonucleotide and CpG DNAs in porcine peripheral blood mononuclear cells2007In: Journal of Virology, ISSN 0022-538X, E-ISSN 1098-5514, Vol. 81, no 10, p. 4919-4927Article in journal (Refereed)
    Abstract [en]

    DNA sequences containing CpG motifs are recognized as immunomodulators in several species. Phosphodiester oligodeoxyribonucleotides (ODNs) representing sequences from the genome of porcine circovirus type 2 (PCV2) have been identified as potent inducers (ODN PCV2/5) or inhibitors (ODN PCV2/1) of alpha interferon (IFN-alpha) production by porcine peripheral blood mononuclear cells (poPBMCs) in vitro. In this study, the IFN-alpha-inducing or -inhibitory activities of specific phosphodiester ODNs were demonstrated to be dependent on their ability to form secondary structures. When a poly(G) sequence was added to a stimulatory self-complementary ODN, high levels of IFN-alpha were elicited, and the induction was not dependent on pretreatment with the transfecting agent Lipofectin. In addition, the IFN-alpha-inducing ODN required the presence of an intact CpG dinucleotide, whereas the inhibitory activity of ODN PCV2/1 was not affected by methylation or removal of the central CpG dinucleotide. Of particular significance, the IFN-alpha inhibition elicited by ODN PCV2/1 was only effective against induction stimulated by DNA control inducers and not RNA control inducers, indicating activity directed to TLR9 signaling. The PCV2 genome as a whole was demonstrated to induce IFN-alpha in cultures of poPBMCs, and the presence of immune modulatory sequences within the genome of PCV2 may, therefore, have implications with regard to the immune evasion mechanisms utilized by PCV2.

  • 15.
    Kwiecinski, J
    et al.
    Sahlgrenska Academy.
    Josefsson, E
    Sahlgrenska Academy.
    Mitchell, J
    Trinity College, Dublin.
    Higgins, J
    Trinity College, Dublin.
    Magnusson, Mattias
    Linköping University, Department of Clinical and Experimental Medicine, Rheumatology. Linköping University, Faculty of Health Sciences.
    Foster, T
    Trinity College, Dublin.
    Jin, T
    Sahlgrenska Academy.
    Bokarewa, M
    Sahlgrenska Academy.
    Activation of Plasminogen by Staphylokinase Reduces the Severity of Staphylococcus aureusSystemic Systemic Infection2010In: Journal of Infectious Diseases, ISSN 0022-1899, E-ISSN 1537-6613, Vol. 202, no 7, p. 1041-1049Article in journal (Refereed)
    Abstract [en]

     

    Background. Theoretical and experimental data support the geographic differentiation strategy as a valuable tool for detecting loci under selection. In the context of Plasmodium falciparum malaria, few populations have been studied, with limited genomic coverage.

    Methods. Wild-type S. aureus strain LS-1, which lacks the ability to produce SAK, was modified by an insertion of the sak gene into its chromosome. The sak gene was integrated in 2 forms—(1) linked to its own promoter and (2) fused to the promoter of the protein A gene—which resulted in the overexpression of SAK. SAK is highly specific for human plg and exhibits almost no activity toward murine plg. To investigate the role played by SAK in a murine infection model, human plg transgenic mice and their wild-type counterparts were inoculated intravenously with congenic S. aureus strains differing in SAK production.

    Results. Human plg transgenic mice inoculated with SAK-expressing strains displayed significantly reduced mortality, less weight loss, and lower bacterial loads in kidneys than did the wild-type mice. No difference in the severity of sepsis was observed between transgenic and wild-type mice infected with a SAK-deficient strain.

    Conclusions. The results suggest that expression of SAK followed by activation of plg alleviates the course of S. aureus sepsis. 

     

     

     

     

     

     

     

     

     

      

     

     

     

     

     

     

     

     

     

     

     

     

     

    Background.

     

    Staphylokinase (SAK) is produced by the majority of Staphylococcus aureus strains. It is an extracellular protein that activates the conversion of human plasminogen (plg) to plasmin. The role played by SAK in staphylococcal infection is unclear.Methods. Wild-type S. aureus strain LS-1, which lacks the ability to produce SAK, was modified by an insertion of the sak gene into its chromosome. The sak gene was integrated in 2 forms—(1) linked to its own promoter and (2) fused to the promoter of the protein A gene—which resulted in the overexpression of SAK. SAK is highly specific for human plg and exhibits almost no activity toward murine plg. To investigate the role played by SAK in a murine infection model, human plg transgenic mice and their wild-type counterparts were inoculated intravenously with congenic S. aureus strains differing in SAK production.Results. Human plg transgenic mice inoculated with SAK-expressing strains displayed significantly reduced mortality, less weight loss, and lower bacterial loads in kidneys than did the wild-type mice. No difference in the severity of sepsis was observed between transgenic and wild-type mice infected with a SAK-deficient strain.Conclusions. The results suggest that expression of SAK followed by activation of plg alleviates the course of S. aureus

    sepsis.

  • 16.
    Magnusson, Mattias
    Linköping University, Department of Clinical and Experimental Medicine, Medical Immunology. Linköping University, Faculty of Health Sciences.
    Typ I IFN skyddar mot antigeninducerad artrit2011In: Best Practice, Vol. 7, p. 12-14Article in journal (Other academic)
  • 17.
    Magnusson, Mattias
    et al.
    Linköping University, Department of Clinical and Experimental Medicine, Division of Inflammation Medicine. Sahlgrenska University Hospital, Göteborg, Sweden.
    Brisslert, M
    Sahlgrenska University Hospital, Göteborg, Sweden.
    Zendjanchi, K
    Sahlgrenska University Hospital, Göteborg, Sweden.
    Lindh, M
    Sahlgrenska University Hospital, Göteborg, Sweden.
    Bokarewa, MI
    Sahlgrenska University Hospital, Göteborg, Sweden.
    Epstein–Barr virus in bone marrow of rheumatoidarthritis patients predicts response to rituximabtreatment2010In: British Journal of Rheumatology, ISSN 0263-7103, E-ISSN 1460-2172, Vol. 49, p. 1911-1919Article in journal (Refereed)
    Abstract [en]

     

    Objectives. Viruses may contribute to RA. This prompted us to monitor viral load and response to anti-CD20 therapy in RA patients.

    Methods. Blood and bone marrow from 35 RA patients were analysed for CMV, EBV, HSV-1, HSV-2, parvovirus B19 and polyomavirus using real-time PCR before and 3 months after rituximab (RTX) treatment and related to the levels of autoantibodies and B-cell depletion. Clinical response to RTX was defined as decrease in the 28-joint disease activity score (DAS-28) >1.3 at 6 months.

    Results. Before RTX treatment, EBV was identified in 15 out of 35 patients (EBV-positive group), of which 4 expressed parvovirus. Parvovirus was further detected in eight patients (parvo-positive group). Twelve patients were negative for the analysed viruses. Following RTX, EBV was cleared, whereas parvovirus was unaffected. Eighteen patients were responders, of which 12 were EBV positive. The decrease in the DAS-28 was significantly higher in EBV-positive group compared with parvo-positive group (P = 0.002) and virus-negative patients (P = 0.04). Most of EBV-negative patients that responded to RTX (75%) required retreatment within the following 11 months compared with only 8% of responding EBV-positive patients. A decrease of RF, Ig-producing cells and CD19+ B cells was observed following RTX but did not distinguish between viral infections. However, EBV-infected patients had significantly higher levels of Fas-expressing B cells at baseline as compared with EBV-negative groups.

    Conclusions. EBV and parvovirus genomes are frequently found in bone marrow of RA patients. The presence of EBV genome was associated with a better clinical response to RTX. Thus, presence of EBV genome may predict clinical response to RTX.

  • 18.
    Magnusson, Mattias
    et al.
    Swedish University of Agriculture Science, Uppsala, Sweden.
    Johansson, E.
    Swedish University of Agriculture Science, Uppsala, Sweden.
    Berg, M.
    Swedish University of Agriculture Science, Uppsala, Sweden.
    Eloranta, Maija-Leena
    Swedish University of Agriculture Science, Uppsala, Sweden.
    Fuxler, L.
    Swedish University of Agriculture Science, Uppsala, Sweden.
    Fossum, C.
    Swedish University of Agriculture Science, Uppsala, Sweden.
    The plasmid pcDNA3 differentially induces production of interferon-alpha and interleukin-6 in cultures of porcine leukocytes2001In: Veterinary Immunology and Immunopathology, ISSN 0165-2427, E-ISSN 1873-2534, Vol. 78, no 1, p. 45-56Article in journal (Refereed)
    Abstract [en]

    An adjuvant effect of invertebrate DNA has been attributed to its relative high frequency of unmethylated CpG dinucleotides. Here we describe the interferon-alpha (IFN-alpha) and interleukin-6 (IL-6) inducing properties of a commonly used eukaryotic expression vector, pcDNA3, in porcine leukocytes. The magnitude of the cytokine response was compared to that induced by the synthetic ds RNA analogue poly(I):poly(C), inactivated preparations of Aujeszkys disease virus (ADV) and the Gram-negative bacteria Actinobacillus pleuropneumoniae. The plasmid, as well as poly(I):poly(C), required lipofectin to induce IFN-alpha production whereas both preparations induced IL-6 irrespective of preincubation with lipofectin. However, the nucleic acid-induced levels of IL-6 were low compared to those induced by A. pleuropneumoniae. The IFN-alpha response elicited by pcDNA3 in the presence of lipofectin was as high as, or higher than that induced by ADV. Interestingly, also A. pleuropneumoniae induced a substantial production of IFN-alpha when preincubated with lipofectin. Plasmid expression was not necessary for induction of IFN-alpha. Furthermore, the IFN-alpha. inducing capacity of pcDNA3 was not reduced when the two predicted immunostimulatory sequences 5AACGTT3 were deleted. Nor did the ability of the plasmid to induce IFN-alpha production decrease when the ampicillin resistance (ampR) gene was replaced with the kanamycin resistance (kanR) gene. However, methylation of all cytidines in CpG dinucleotides of pcDNA3 abolished the IFN-alpha inducing capacity. These in vitro results indicate an immunomodulatory role of bacterial DNA also in the pig. Unmethylated CpG dinucleotides are crucial for induction of IFN-alpha by the plasmid, but other CpG motifs than those within the 5AACGTT3 sequences of the ampR gene contribute to this induction in porcine cells. (C) 2001 Elsevier Science B.V. All rights reserved.

  • 19.
    Magnusson, Mattias
    et al.
    Swedish University of Agriculture Science, Uppsala, Sweden .
    Magnusson, S.
    Swedish University of Agriculture Science, Uppsala, Sweden .
    Vallin, H.
    Swedish University of Agriculture Science, Uppsala, Sweden .
    Rönnblom, L.
    University Hospital, Uppsala, Sweden.
    Alm, G. V.
    Swedish University of Agriculture Science, Uppsala, Sweden .
    Importance of CpG dinucleotides in activation of natural IFN-alpha-producing cells by a lupus-related oligodeoxynucleotide2001In: Scandinavian Journal of Immunology, ISSN 0300-9475, E-ISSN 1365-3083, Vol. 54, no 6, p. 543-550Article in journal (Refereed)
    Abstract [en]

    The oligodeoxyribonucleotide (ODN) 5-TTTTCAATTCGAAGATGAAT-3 (ODN H), identified in systemic lupus erythematosus (SLE) serum, induced the production of interferon (IFN)-alpha in human peripheral blood mononuclear cells (PBMC) when combined with lipofectin. Flow cytometric analysis with staining for surface antigens and intracellular IFN-alpha, showed that the IFN-alpha -producing cells (IPC) were the natural IPC, also termed type 2 dendritic cell precursors (pDC2) or plasmacytoid monocytes. The importance of unmethylated CpG dinucleotides for the interferogenic activity of ODN was studied. Methylation of CpG impaired the activity of single-stranded (ss) ODN H, but increased that of the complementary ssODN I. Furthermore, CpG-methylated double-stranded (ds) ODN H-met-I-met lost, but hemimethylated dsODN H-I-met retained interferogenic activity. Inversion of the CpG to GpC had no effect on the interferogenic activity of ssODN H, increased that of ssODN I, however abolished the activity of dsODN H-I. Alteration of the CpG in ODN H to ApG and in the ODN I to CpT destroyed their activity. The induction of IFN-alpha is therefore sequence-specific, but unmethylated CpGs are not always required, especially not in ssODNs. Interferogenic DNA sequences could therefore be more frequent in eukaryotic genomes than previously thought and their capacity to activate natural IPC may have implications for immune responses to microbial antigens and nuclear autoantigens.

  • 20.
    Magnusson, Mattias
    et al.
    Sahlgrenska Academy at University of Gothenburg, Sweden.
    Tarkowski, Andrej
    Sahlgrenska Academy at University of Gothenburg, Sweden.
    Exogenous Nucleic Acids Contribute to Joint Inflammation in Rheumatoid Arthritis by Activating an Anti-Viral Interferon Response2009In: Autoimmunity: Role, Regulation and Disorders / [ed] Fynn L. Vogel and Lucas F. Zimmermann, Nova Science Publishers, Inc., 2009Chapter in book (Other academic)
  • 21.
    Magnusson, Mattias
    et al.
    University of Gothenburg, Sweden.
    Tobes, Raquel
    Granada Centre Europeo Empresas and Innovac, Spain.
    Sancho, Jaime
    Instituto de Parasitologia y Biomedicina López-Neyra, Armilla, Spain.
    Pareja, Eduardo
    Granada Centre Europeo Empresas and Innovac, Spain.
    Cutting edge: Natural DNA repetitive extragenic sequences from Gram-negative pathogens strongly stimulate TLR92007In: Journal of Immunology, ISSN 0022-1767, E-ISSN 1550-6606, Vol. 179, no 1, p. 31-35Article in journal (Refereed)
    Abstract [en]

    Bacterial DNA exerts immunostimulatory effects on mammalian cells via the intracellular TLR9. Although broad analysis of TLR9-mediated immunostimulatory potential of synthetic oligonucleotides has been developed, which kinds of natural bacterial DNA sequences are responsible for immunostimulation are not known. This work provides evidence that the natural DNA sequences named repetitive extragenic palindromic (REPs) sequences present in Gram-negative bacteria are able to produce innate immune system stimulation via TLR9. A strong induction of IFN-alpha production by REPs from Escherichia coli, Salmonella enterica, Pseudomonas aeruginosa, and Neisseria meningitidis was detected in splenocytes from 129 mice. In addition, the involvement of TLR9 in immune stimulation by REPs was confirmed using B6.129P2-Tlr9(tm1Aki) knockout mice. Considering the involvement of TLRs in Gram-negative septic shock, it is conceivable that REPs play a role in its pathogenesis. This study highlights REPs as a potential novel target in septic shock treatment.

  • 22.
    Magnusson, Mattias
    et al.
    University of Gothenburg, Sweden.
    Zare, Fariba
    University of Gothenburg, Sweden.
    Tarkowski, Andrej
    University of Gothenburg, Sweden.
    Requirement of type I interferon signaling for arthritis triggered by double-stranded RNA2006In: Arthritis and Rheumatism, ISSN 0004-3591, E-ISSN 1529-0131, Vol. 54, no 1, p. 148-157Article in journal (Refereed)
    Abstract [en]

    Objective. Arthralgias and overt arthritides are often associated with viral infections. Viral infections expose the infected host to proinflammatory double-stranded RNA (dsRNA), which can cause joint inflammation and is a potent activator of interferon-alpha (IFN alpha). The aim of this study was to determine the role of IFN alpha and dsRNA-related signaling molecules in the onset of joint inflammation induced by viral dsRNA. Methods. IFN alpha and different forms of RNA were injected into the knee joints of wild-type mice, mice lacking the type I interferon receptor (IFNAR(-/-)), and mice deficient in dsRNA-dependent protein kinase (PKR-/-). Histologic evidence of joint damage and the ability of splenocytes to produce cytokines in response to dsRNA or IFNa were assessed. Results. Viral dsRNA, but not short single-stranded RNA, induced arthritis. The arthritis was aggravated by intracellular delivery of dsRNA. The expression of PKR was not mandatory for dsRNA-induced joint inflammation. In contrast, IFN alpha/beta signaling was important for dsRNA-induced joint inflammation because IFNAR(-/-) mice did not develop arthritis. Furthermore, intraarticular deposition of IFNa induced arthritis in PKR-/- and control mice, whereas IFNAR(-/-) mice were protected. The arthritogenic effect of IFN alpha was attenuated by in vivo depletion of monocyte/macrophages. Conclusion. Arthritis triggered by dsRNA is not dependent on the expression of the dsRNA-signaling molecule PKR (or Toll-like receptor 3, as previously shown), but is associated with the ability to produce type I IFN and is critically dependent on type I IFN receptor signaling. The intrinsic arthritogenic properties of IFN alpha implicate a role of this cytokine in joint manifestations triggered by various interferogenic stimuli.

  • 23.
    Mera, Simona
    et al.
    Sahlgrenska University Hospital, Göteborg, Sweden.
    Magnusson, Mattias
    Sahlgrenska University Hospital, Göteborg, Sweden.
    Tarkowski, Andrej
    Sahlgrenska University Hospital, Göteborg, Sweden.
    Bokarewa, Maria
    Sahlgrenska University Hospital, Göteborg, Sweden.
    Extracellular survivin up-regulates adhesion molecules on the surface of leukocytes changing their reactivity pattern2008In: Journal of Leukocyte Biology, ISSN 0741-5400, E-ISSN 1938-3673, Vol. 83, no 1, p. 149-155Article in journal (Refereed)
    Abstract [en]

    Rheumatoid arthritis (RA) is an autoimmune disease with joints as a principal target of inflammation. We have shown recently that the extracellular expression of the antiapoptotic protein survivin is associated with a destructive course of RA. Here, we address the potential impact of extracellular survivin on peripheral blood leukocytes (PBL). The binding of survivin to the surface of human PBL as well as the expression of adhesion molecules were assessed by FACS. The expression of adhesion molecules on leukocytes as a function of circulating survivin was analyzed in blood of 24 patients with RA and compared with eight healthy individuals. We show that extracellular survivin expresses immunomodulatory properties. It binds to the surface of the majority of granulocytes and a significant part of lymphocytes and monocytes inducing the activation of alpha-chains of beta-integrins and their ligand ICAM-1. Survivin-induced expression of alpha-chains of beta(2)-integrins is regulated by p38 MAPK and PI-3K but not by the NF-kappa B signaling pathway. Clinical relevance of our findings is supported by the in vivo association of high circulating survivin levels with an increased expression of CD11c on monocytes and granulocytes in RA patients. The results of our study demonstrate that extracellular survivin affects the phenotype of leukocytes having a possible impact on homing of inflammatory cells during arthritis.

  • 24.
    Narendra, Sudeep Chenna
    et al.
    Linköping University, Department of Clinical and Experimental Medicine, Division of Inflammation Medicine. Linköping University, Faculty of Health Sciences.
    Chalise, Jaya Prakash
    Linköping University, Department of Clinical and Experimental Medicine, Division of Inflammation Medicine. Linköping University, Faculty of Health Sciences.
    Höök, Nina
    Rheumatology and Inflammation Research, Sahlgrenska University Hospital, Göteborgs Universitet, Göteborg, Sweden.
    Magnusson, Mattias
    Linköping University, Department of Clinical and Experimental Medicine, Division of Inflammation Medicine. Linköping University, Faculty of Health Sciences.
    Dendritic cells activated by double-stranded RNA induce arthritis via autocrine type I IFN signaling.2014In: Journal of Leukocyte Biology, ISSN 0741-5400, E-ISSN 1938-3673, Vol. 95, no 4, p. 661-666Article in journal (Refereed)
    Abstract [en]

    Viral dsRNA can be found at the site of inflammation in RA patients, and intra-articular injection of dsRNA induces arthritis by activating type I IFN signaling in mice. Further, DCs, a major source of IFN-α, can be found in the synovium of RA patients. We therefore determined the occurrence of DCs in dsRNA-induced arthritis and their ability to induce arthritis. Here, we show, by immunohistochemistry, that cells expressing the pan-DC marker CD11c and the pDC marker 120G8 are present in the inflamed synovium in dsRNA-induced arthritis. Flt3L-generated and splenic DCs preactivated with dsRNA before intra-articular injection, but not mock-stimulated cells, clearly induced arthritis. Induction of arthritis was dependent on type I IFN signaling in the donor DCs, whereas IFNAR expression in the recipient was not required. Sorting of the Flt3L-DC population into cDCs (CD11c(+), PDCA-1(-)) and pDCs (CD11c(+), PDCA-1(+)) revealed that both subtypes were arthritogenic and produced type I IFN if treated with dsRNA. Taken together, these results demonstrate that viral nucleic acids can elicit arthritis by activating type I IFN signaling in DCs. Once triggered, autocrine type I IFN signaling in dsRNA-activated DCs is sufficient to propagate arthritis.

  • 25.
    Svensson, Alexandra
    et al.
    University of Gothenburg, Sweden.
    Bellner, Lars
    University of Gothenburg, Sweden.
    Magnusson, Mattias
    University of Gothenburg, Sweden.
    Eriksson, Kristina
    University of Gothenburg, Sweden.
    Role of IFN-alpha/beta signaling in the prevention of genital herpes virus type 2 infection2007In: Journal of Reproductive Immunology, ISSN 0165-0378, E-ISSN 1872-7603, Vol. 74, no 1-2, p. 114-123Article in journal (Refereed)
    Abstract [en]

    This study has shown that IFN-alpha/beta signaling is crucial for combating primary herpes simplex virus type 2 (HSV-2) infection and for responding to immunotherapy using ligands to TLR3, 7 and 9, but not for vaccine-induced immunity. Both genital viral replication and the disease progression were enhanced in HSV-2-infected mice lacking the IFN-alpha/beta receptor (IFN-alpha/beta R-/-). IFN-alpha/beta R-/mice were, however, able to mount a normal HSV-2-specific Th1 response and acquired sterilizing immunity following vaccination. Anti-viral treatments using agonists to TLR3, 7 and 9 by administration of synthetic dsRNA, imiquimod and oligonucleotides containing unmethylated CpG motifs, respectively, were strongly dependent on IFN-alpha/beta receptor signaling for their efficacy. Even though all treatments had a weak impact on local vaginal viral replication in infected IFN-alpha/beta R-/- animals, they did not affect disease progression or mortality in these animals as opposed to wild type controls where all three treatments reduced viral replication as well as disease severity and mortality. Lack of IFN-alpha/beta R signaling also blocked production of IFN-gamma and TNF-alpha in response to TLR9 activation. These studies have shown that IFN-alpha/beta receptor signaling is important for multiple events in the anti-viral defense. (C) 2006 Elsevier Ireland Ltd. All rights reserved.

  • 26.
    Tarkowski, Andrej
    et al.
    University of Gothenburg, Sweden.
    Verdrengh, Margareta
    University of Gothenburg, Sweden.
    Jonsson, Ing-Marie
    University of Gothenburg, Sweden.
    Magnusson, Mattias
    University of Gothenburg, Sweden.
    Foster, Simon J.
    University of Sheffield, UK .
    Liu, Zai-Quing
    University of Gothenburg, Sweden.
    Carbohydrates and biology of staphylococcal infections2005In: Advances in Experimental Medicine and Biology, ISSN 0065-2598, E-ISSN 2214-8019, Vol. 564, p. 115-116Article in journal (Refereed)
  • 27.
    Wattrang, Eva
    et al.
    Swedish University of Agricultural Sciences, Uppsala, Sweden.
    Berg, Mikael
    Swedish University of Agricultural Sciences, Uppsala, Sweden.
    Magnusson, Mattias
    Swedish University of Agricultural Sciences, Uppsala, Sweden.
    Immunostimulatory DNA activates production of type I interferons and interleukin-6 in equine peripheral blood mononuclear cells in vitro2005In: Veterinary Immunology and Immunopathology, ISSN 0165-2427, E-ISSN 1873-2534, Vol. 107, no 3-4, p. 265-279Article in journal (Refereed)
    Abstract [en]

    This study aimed to evaluate different nucleic acid preparations as cytokine inducers in equine cells. To induce cytokine production, bacterial plasmid DNA or short synthetic oligodeoxyribonucleotides (ODN), with or without the transfection reagent lipofectin, were added to cultures of purified equine peripheral blood mononuclear cells (PBMC). Cytokine activity was detected with bioassays in cell culture supernatants after 24 h of induction and cytokine mRNA expression was detected using RT-PCR at 6 h post induction. For IFN-alpha/beta it was found that both plasmid DNA and phosphodiester ODN, containing an unmethylated CpG-motif, were able to induce IFN production in the presence of lipofectin but not without. The levels of IFN varied with individuals and were often quite low. Moreover, methylation or removal of the CpG sequence completely abolished IFN induction. CpG-containing ODN with poly-guanine (G) sequences in the 5 and 3 ends induced considerably higher levels of IFN, especially when the poly-G sequences had a phosphorothioate backbone. ODN with poly-G sequences also had the ability to induce IFN in the absence of lipofectin but the levels of IFN induced were radically reduced compared to those induced with lipofectin. In contrast to IFN, which was only detected upon induction, low spontaneous IL-6 production was observed in unstimulated control cultures. Nevertheless, plasmid DNA and CpG-containing ODN were able to increase the IL-6 production threefold. All the IFN inducing ODN also induced IL-6 production and the levels of IL-6 induced seemed influenced by addition of lipofectin and presence of poly-G sequences in the same way as was observed for the IFN-production. However, a complete phosphorothioate ODN with a central CpG-motif and poly-C sequences, that did not induce IFN, readily induced IL-6 both in the presence and absence of lipofection. In addition, there was also evidence that some ODN induced increased expression of IL-12p4O mRNA. To conclude, equine PBMC were able to recognize CpG-DNA and respond with both IFN-alpha/beta and/or IL-6 production. The levels of cytokine induced, and sometimes which cytokine induced, varied with, e.g., CpG-motifs used, the presence of poly-G sequences, ODN backbone chemistry and presence of lipofectin. (c) 2005 Elsevier B.V. All rights reserved.

  • 28.
    Ying, Fei
    et al.
    Affiliated Hospital, Guiyang Medical College.
    Chalise, Jaya Prakash
    Linköping University, Department of Clinical and Experimental Medicine, Rheumatology. Linköping University, Faculty of Health Sciences.
    Chenna Narendra, Sudeep
    Linköping University, Department of Clinical and Experimental Medicine, Rheumatology. Linköping University, Faculty of Health Sciences.
    Magnusson, Mattias
    Linköping University, Department of Clinical and Experimental Medicine, Rheumatology. Linköping University, Faculty of Health Sciences.
    Type I IFN protects against antigen-induced arthritis2011In: European Journal of Immunology, ISSN 0014-2980, E-ISSN 1521-4141, Vol. 41, no 6, p. 1687-1695Article in journal (Refereed)
    Abstract [en]

    Autoimmune diseases including rheumatoid arthritis (RA) involve immune reactions against specific antigens. The type I IFN system is suspected to promote autoimmunity in systemic lupus erythematosus, but may also dampen immune reactions in e. g. inflammatory bowel disease. This prompted us to investigate the role of type I IFN in antigen-induced arthritis (AIA). The importance of type I IFN in methylated (m) BSA-induced arthritis was studied by using mice deficient for the type I IFN receptor (IFNAR) and by administration of the IFN-alpha activator viral double-stranded (ds) RNA or recombinant IFN-alpha at antigen sensitization. In IFNAR knock-out mice, arthritis severity was significantly higher than in WT mice. Administration of dsRNA at antigen sensitization protected WT but not IFNAR KO mice from arthritis. Also, addition of recombinant IFN-alpha during the immunization, but not the induction phase of arthritis, almost abolished arthritis. Protection mediated by IFN-alpha was accompanied by delayed and decreased antigen-specific proliferative responses, including impaired lymph node recall responses after intra-articular antigenic challenge. In conclusion, we demonstrate that type I IFN can prevent joint inflammation by downregulating antigen-specific cellular immunity.

  • 29.
    Zare, Fariba
    et al.
    University of Gothenburg, Sweden.
    Magnusson, Mattias
    University of Gothenburg, Sweden.
    Bergstrom, Tomas
    University of Gothenburg, Sweden.
    Brisslert, Mikael
    University of Gothenburg, Sweden.
    Josefsson, Elisabet
    University of Gothenburg, Sweden.
    Karlsson, Anna
    University of Gothenburg, Sweden.
    Tarkowski, Andrej
    University of Gothenburg, Sweden.
    Uric acid, a nucleic acid degradation product, down-regulates dsRNA-triggered arthritis2006In: Journal of Leukocyte Biology, ISSN 0741-5400, E-ISSN 1938-3673, Vol. 79, no 3, p. 482-488Article in journal (Refereed)
    Abstract [en]

    Uric acid, the naturally occurring degradation product of purine metabolism, is a danger signal, driving maturation of dendritic cells. It is well known that uric acid crystals display potent proinflammatory properties-the cause of gout-whereas the biological properties of soluble uric acid are less well documented. We have demonstrated previously that nucleic acids of endogenous and exogenons origin display proinflammatory properties. The aim of the present study was to assess the impact of soluble uric acid on in vivo inflammatory responses. Mice were administered with uric acid suspension in saline or saline alone prior to induction of nentrophil-mediated inflammation, delayed-type hypersensitivity, histamin-induced edema (measure of vasodilation capacity), as well as double-stranded (ds)RNA-triggered arthritis. Frequency and severity of arthritis were decreased significantly in mice exposed to dsRNA and simultaneously treated with uric acid as compared with salline-treated controls. Also, granulocyte-mediated inflammatory response and vasodilation capacity were reduced significantly in mice treated with uric acid as compared with their control group. The data suggest that down-regulation of inflammation was mediated by skewing the inflammatory response from the peripheral sites to the peritoneal cavity and down-regulating vasodilatatory capacity and thereby affecting leukocyte migration. In contrast, the T cell-mediated delayed-type hypersensitivity reaction was not affected significantly in mice exposed to uric acid. These findings demonstrate that uric acid displays a potent, distant anti-inflammatory effect in vivo. This property seems to be mediated by down-regulation of nentrophil influx to the site of inflammatory insult.

  • 30.
    Zare, Fariba
    et al.
    University of Gothenburg, Sweden .
    Magnusson, Mattias
    University of Gothenburg, Sweden .
    Nilsson Mollers, Linda
    University of Gothenburg, Sweden .
    Jin, Tao
    University of Gothenburg, Sweden .
    Tarkowski, Andrej
    University of Gothenburg, Sweden .
    Bokarewa, Maria
    University of Gothenburg, Sweden .
    Single-stranded polyinosinic acid oligonucleotides trigger leukocyte production of proteins belonging to fibrinolytic and coagulation cascades2008In: Journal of Leukocyte Biology, ISSN 0741-5400, E-ISSN 1938-3673, Vol. 84, no 3, p. 741-747Article in journal (Refereed)
    Abstract [en]

    The present study assessed the inductory effects of ds- and ssRNA on the leukocyte production of proteins belonging to fibrinolytic and coagulation cascades. Murine splenocytes were stimulated with dsRNA [polyinosinic: polycytidylic acid (polyIC)] and ssRNA sequences [polyinosinic acid (polyI), polycytidylic acid (polyC), and polyuridylic acid (polyU)]. The expression of plasminogen (Plg), tissue factor (TF), IL-6, and IFN-alpha was assessed. Intracellular tranduction mechanisms activated by oligonucleotides were evaluated using specific inhibitors of signaling pathways and genetically modified mice. polyIC efficiently and dose-dependently induced the expression of Plg, IL-6, and IFN-alpha, whereas TF was not induced by polyIC. polyI was unable to trigger IFN-alpha production, and it was efficiently inducing Plg and TF. IFN-alpha R and dsRNA-dependent protein kinase signaling were not required for the polyI-induced production of Plg or TF. Neither polyU nor polyC induced the expression of Plg or TF. Importantly, the presence of U- and C-nucleotide strands in the dsRNA significantly reduced expression of Plg and TF compared with polyI alone. Exposure of splenocytes to polyI activated the NF-kappa B pathway followed by the expression of TF and IL-6. In contrast, Plg production did not require NF-kappa B, was only partly down-regulated by p38 MAPK inhibitor, and was efficiently inhibited by insulin, indicating a different mechanism for its induction. ssRNA exerts its TF-generating properties through NF-kappa B activation in an IFN-alpha-independent manner. The expression of fibrinolytic versus coagulation proteins is regulated through distinctly different transduction pathways. As fibrinolytic and coagulation cascades are important components of inflammatory homeostatis, these findings might have importance for developement of new, targeted therapies.

1 - 30 of 30
CiteExportLink to result list
Permanent link
Cite
Citation style
  • apa
  • harvard1
  • ieee
  • modern-language-association-8th-edition
  • vancouver
  • oxford
  • Other style
More styles
Language
  • de-DE
  • en-GB
  • en-US
  • fi-FI
  • nn-NO
  • nn-NB
  • sv-SE
  • Other locale
More languages
Output format
  • html
  • text
  • asciidoc
  • rtf